volume 17 Number 14 1989 Nucleic Acids Research The sequence of cDNA of bovine coronavirus 32K nonstructural gene Graham J.Cox, Michael D.Parker and Lome A.Babiuk Veterinary Infectious Disease Organization, 124 Veterinary Road, Saskatoon, Saskatchewan S7N 0W0, Canada Submitted June 15, 1989 EMBL accession no. X15445 In addition to the four structural proteins of bovine coronavirus a minimum of four virus-encoded nonstructural proteins are found in infected cell3. The nucleotide sequence of the NS 32 is presented. The gene is situated immediately upstream from the E3 gene and terminates within the NS32-E3 conserved intergenic region. An ORF extends from nucleotides 15 to 845 and the computer generated translational product of 32K is in agreement with our observations (unpublished) and reports for other coronaviruses. In addition to the conserved intergenic region (single underline) this gene shares homology (65% at the nt level, 45% at the aa level) with the ORF-1 in mRNA2 of MHV- A592. 1 TCTAAACTTTAAGAATGGCAGTTGCTTATGCAGACAAGCCTAATCACTTTATTAATTTTC 61 CACTTACCCAGTTTGAGGGTTTTGTGTTAAATTATAAAGGTTTACAATTTCAACTTCTCG 121 ATGAAGGAGTGGATTGTAAAATACAAACAGCGCCGCACATTAGTCTTGCTATGCTGGATA 181 TTCAGCCTGAAGACTATAGAAGTGTTGATGTTGCTATTCAAGAAGTTATTGATGACATGC 241 ATTGGGGTGAGGGCTTTCAGATTAAATTTGATAACCCCCATATCCTAGGAAGATGCATAG 301 TTTTAGATGTTAAAGGTGTAGAAGAATTGCATGATGATTTAGTTAATTACATTCGTGATA 361 AAGGTTGTGTTGCTGACCAATCCAGGAAATGGATTGGACATTGCACCATAGCCCAACTCA 4 21 CGGATGCTGCACTTTCCATTAAGGAAAATGTTGATTTCATAAACAGCATGCAATTCAATT 4 81 ATAAAATCACTATCAACCCCTCATCACCGGCTAGACTTGAAATAGTTAAGCTTGGTGCTG 541 AAAAGAAAGATGGTTTTTATGAAACCATAGTTAGCCACTGGATGGGAAGTCGTTTTGAAT 601 ATAATCCACCCACTGATAAGCTAGCTATGATTATGGGTTATTGTTGTTCAGAAGTGGTGC 661 GTAAAGAGCTAGAAGAAGGTGATCTTCCCGAGAATGATGATGATGCTTGGTTTAAGCTAT 721 CGTACCATTATGAAAACAATTCTTGGTTCTTTCGACATGTCTACAGGAAAGTTCTTATTT 781 CCGTAAGTCTTGTAAATTTAGATTGTAATTGTTTGGGGTTTTATGAATCTCCAGTTGAAG 841 AAGACTAAAC References 1. Parker, M.D. et al (1989) J. Gen. Virol. 70:155-164 2. Luytjea, W. et al (1988) Virol. 166:415-422 5847 at Stockholms Universitet on September 3, 2015http:/nar.oxfordjournals.org/Downloaded from