THE NU SKIN OPPORTUNITYThe worlds leading anti-aging company is addressing the sources of aging, not just the signs and symptoms.TRADITION OF INNOVATION2 Nu Skin 180 Galvanic Spa Scanner Nano g3 TruFace essence ultraSIGNSDeveloping products that address the sources of aging, not just the signs and symptoms.What is ageLOC?D. James Morr, PhD Department of Medicinal Chemistry and Molecular Pharmacology and Dorothy M. Morr, PhDDepartment of Foods and Nutrition Purdue University, West Lafayette, IndianaARNOX, AN AGING ENZYME: 1ST AGELOC SOURCE OF AGINGIdentified a NOX which increases with age Nicotinamide adenine dinucleotide OXidase, a hydroquinone oxidaseNOXQuinone ReductaseQ10Q10H21/2 O2H2ONAD(P)H+ H+NAD(P)+ProteinSSProteinOutsideInsidePlasma Membrane2 O2SH SH2 O2-arNOX Generates Superoxide O2-A powerful free-radical generatorGENESIS OF AGELOCWhy Some People Look Years Younger Than They Really Are.The arNOX discoveryhelped explainHUMAN GENOME Our genome encodes for: our looks our size how our bodies work our health our behaviors Our longevityGenes impact structure and function of the bodyHealth or Beauty IndexYEARS 2003 discovery after 20 years of research: 25,000 30,000 genes form the human genome Twenty Labs with hundreds of scientists (United States, the United Kingdom, France, Germany, Japan and China), $3 billionAfter 20 yrs Human Genome SequencedThe Human Genome consistsof at least 25,000 30,000 genesGATCGACTCCTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGGATCGACTCC CTTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTT CCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCT GGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGG VGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVG CAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCA GCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGC GTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGCGT GATCGACTCCCTTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGAT CGACTCCCTTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGAATAT CGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGCGTGAATATCG ATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGCGTGAATATCGATA GAGATCCCTTCGAGAAAGTGATCGACTCCC- TTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGT AAAGTNu Skin Enterprises Center for Anti -Aging Research (NSE:CAAR)NSE:CAAR Anti-Aging Genetic ExpertsPublished over 300 scientific papers, and their insights have changed the way aging is viewed. NSE: Center for Anti-Aging Research Experts in the study of the ultimate source of aging; our genes. 30 Years of pioneering anti-aging research. Their work both details the genetic basis of aging, and demonstrates that biological aging is no longer considered an inexorable or inevitable process. CellCellnucleusnucleusDNA DNA (stored on chromosomes)(stored on chromosomes)Genetics 101Genetics 101ULTIMATE SOURCE OF AGING = GENE EXPRESSION As you age, your genes dont change Which genes are turned on and off does change (e.g. gene expression). Expression levels are influenced by your environment (stress, nutrition, etc)IDENTICAL TWINS ARE DIFFERENT How is this possible, as their genes are the same? It turns out that while the genes are identical, the level at which gene is turned on and off changes based on environmental factors (e.g. gene expression). This causes the differences you can see.Yellow shows where the twins have similar gene regulation. Red and Green indicate differences (up and down regulation).To better understand aging, we need to know the expression level for every gene. arNOXElastinin a single experiment.Gene Expression Profiling 101arNOX (0)Elastin (8)Collagen (6)MMP (2)Microarray (e.g. Gene Chip) Young Skin Key- High Activity- Off- Medium Activity- Low ActivityGene 1 arNOXGene 2 ElastinGene 3 CollagenGene 4 MMPYoung Skin Fibroblast (Hypothetical)DNAmRNAThe expression level for every gene in a single experiment!arNOXElastinKey- High Activity- Off- Medium Activity- Low ActivityDNA Microarray Gene Map Over 25000 GenesNuSkin ageLOC Approach Identify Youth Gene Clusters (YGCs), and understand their youthful expression patterns Target - Investigate the effect different ingredients have on YGCs. Reset - Develop formulae that reset these YGCs back to their youthful state, thus restoring the youthful biochemistry of a cell.What is a Youth Gene Cluster (YCG) These are groups of genes (e.g. clusters) that work together to exert a specific function in a tissue associated with youthfulness. Tissue specific Act as master regulators of aging.Younger Than Chronological AgeIn additional to understanding the genetic basis of aging in Humans, mice, fruit flies, yeast and roundworms are also fruitful models for the genetic/aging scientistGene Expression Profiling 101Gene 1 arNOXGene 2 ElastinGene 3 CollagenGene 4 MMPYoung Skin Fibroblast (Hypothetical)DNAmRNAGene 1 arNOXGene 2 ElastinGene 3 CollagenGene 4 MMPOld Ski