The Human Sodium Iodide Symporter as a Reporter Gene forStudying Middle East Respiratory Syndrome CoronavirusPathogenesisSvetlana Chefer,aJurgen Seidel,aAdam S. Cockrell,bBoyd Yount,bJeffrey Solomon,cKatie R. Hagen,aDavid X. Liu,aLouis M. Huzella,aMia R. Kumar,dElena Postnikova,aJ. Kyle Bohannon,aMatthew G. Lackemeyer,aKurt Cooper,aAriel Endlich-Frazier,dHeema Sharma,dDavid Thomasson,aChristopher Bartos,aPhilip J. Sayre,aAmy Sims,bJulie Dyall,aMichael R. Holbrook,aPeter B. Jahrling,a,dRalph S. Baric,bReed F. JohnsondaIntegrated Research Facility, National Institute of Allergy and Infectious Diseases, National Institutes of Health,Frederick, Maryland, USAbDepartment of Epidemiology, University of North CarolinaChapel Hill, Chapel Hill, North Carolina, USAcClinical Research Directorate/Clinical Monitoring Research Program, Leidos Biomedical Research, Inc.,Frederick National Laboratory for Cancer Research, Frederick, Maryland, USAdEmerging Viral Pathogens Section, Laboratory of Immunoregulation, Division of Intramural Research, NationalInstitute of Allergy and Infectious Diseases, National Institutes of Health, Frederick, Maryland, USAABSTRACTSingle photon emission computed tomography (SPECT) is frequentlyused in oncology and cardiology to evaluate disease progression and/or treatmentefficacy. Such technology allows for real-time evaluation of disease progression andwhen applied to studying infectious diseases may provide insight into pathogenesis.Insertion of a SPECT-compatible reporter gene into a virus may provide insight intomechanisms of pathogenesis and viral tropism. The human sodium iodide symporter(hNIS), a SPECT and positron emission tomography reporter gene, was inserted intoMiddle East respiratory syndrome coronavirus (MERS-CoV), a recently emerged virusthat can cause severe respiratory disease and death in afflicted humans to obtain aquantifiable and sensitive marker for viral replication to further MERS-CoV animalmodel development. The recombinant virus was evaluated for fitness, stability, andreporter gene functionality. The recombinant and parental viruses demonstratedequal fitness in terms of peak titer and replication kinetics, were stable for up to sixin vitro passages, and were functional. Further in vivo evaluation indicated variablestability, but resolution limits hampered in vivo functional evaluation. These datasupport the further development of hNIS for monitoring infection in animal modelsof viral disease.IMPORTANCEAdvanced medical imaging such as single photon emission computedtomography with computed tomography (SPECT/CT) enhances fields such as oncol-ogy and cardiology. Application of SPECT/CT, magnetic resonance imaging, and pos-itron emission tomography to infectious disease may enhance pathogenesis studiesand provide alternate biomarkers of disease progression. The experiments describedin this article focus on insertion of a SPECT/CT-compatible reporter gene into MERS-CoV to demonstrate that a functional SPECT/CT reporter gene can be inserted into avirus.KEYWORDSMERS, coronavirus, medical imaging, reporter geneRecombinant viruses expressing reporter genes such as luciferase or fluorescentproteins or viral proteins fused with a reporter protein have been used as screeningtools for countermeasures and to understand pathogenesis (14). While the applicationof reporter gene technology has provided insight into viral pathogenesis, these exper-Received 28 September 2018 Accepted 26October 2018 Published 12 December 2018Citation Chefer S, SeidelJ,CockrellAS,YountB,SolomonJ,HagenKR,LiuDX,HuzellaLM,KumarMR,PostnikovaE,BohannonJK,LackemeyerMG,CooperK,Endlich-FrazierA,SharmaH,ThomassonD,BartosC,SayrePJ,SimsA,DyallJ,HolbrookMR,JahrlingPB,BaricRS,JohnsonRF.2018.ThehumansodiumiodidesymporterasareportergeneforstudyingMiddleEastrespiratorysyndromecoronaviruspathogenesis.mSphere3:e00540-18.https:/doi.org/10.1128/mSphere.00540-18.Editor Matthew B. Frieman, University ofMaryland, College ParkThis is a work of the U.S. Government and isnot subject to copyright protection in theUnited States. Foreign copyrights may apply.Address correspondence to Reed F. Johnson,johnsonreedniaid.nih.gov.RESEARCH ARTICLEHost-Microbe BiologycrossmNovember/December 2018Volume 3Issue 6e00540-18msphere.asm.org1 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from iments are frequently hampered by sacrificing the subject to identify the source of thereporter gene signal (57). Applying medical imaging technology, such as singlephoton emission computed tomography (SPECT) or positron emission tomography(PET), to animal models of human infectious disease provides the capability to seriallymonitor anatomical and physiological responses to infection in the same subject thatcan be clinically translated. Generating a virus that carries a SPECT/PET-compatiblereporter gene furthers that capability by serial, real-time evaluation of virus kinetics,identification of tissue tropism, and determination of pathogenic mechanisms. Thehuman sodium iodide symporter (hNIS) gene has emerged as one of the most prom-ising reporter genes in preclinical and translational research for oncology and genetherapy (8, 9).The hNIS symporter is an intrinsic plasma membrane protein belonging to thesodium/solute symporter family, which drives negatively charged solutes into thecytoplasm using a sodium ion electrochemical gradient (10). The advantages of hNIS asan imaging reporter gene include its relatively small size (?2 kb), wide availability ofsubstrates, such as radioiodines, tetrafluoroborate, and99mTc-pertechnetate, and well-understood metabolism and clearance mechanisms of these substrates (11). Oncolyticviruses such as measles virus and replication-deficient adenovirus that contain hNIShave demonstrated value as theranostics, as hNIS is used both as a therapeutic platformand to track the therapeutic effect (8, 9). In addition, hNIS is unlikely to perturb theunderlying cell biochemistry, and no negative effects of resultant sodium influx havebeen observed (12). Finally, once incorporated into the viral genome, the relativelysmall size of the reporter gene is less likely than larger reporter genes to alter viralpathogenic properties (13).Middle East respiratory syndrome-CoV (MERS-CoV) recently emerged and is associ-ated with Middle East respiratory syndrome (MERS), a severe, frequently lethal pneu-monia in humans (1416). Viral pathogenesis is not well understood, in part, becauseof limited autopsy information and a lack of animal models that fully recapitulatehuman disease. As with most lethal infectious diseases, animal models are the corner-stone for preclinical countermeasure evaluation and understanding pathogenesis.MERS-CoV provides a unique opportunity to incorporate reporter gene technology tobetter understand viral pathogenesis because its larger genome size may be moreamenable to reporter gene insertion than other viruses.Animal models for MERS are under development with no single model identified asthe standard. New World and Old World nonhuman primates infected with MERS-CoVdevelop transient respiratory disease with little or no virus replication and varyingdisease outcome (1719). MERS-CoV-exposed New Zealand White rabbits developlimited lung pathology with evidence of viral replication but did not show overt clinicalsigns of disease (20, 21). Transgenic mice globally expressing the human CD26/dipeptidyl peptidase 4 (DPP4) receptor (22), expressing the human receptor under themurine promoter (23) or transduced with DPP4 receptor (24) become permissive to thevirus but do not develop fulminant, lethal respiratory disease. Therefore, changes inreporter gene signal may serve as a biomarker for countermeasure evaluation.The objective of this study was to incorporate hNIS into MERS-CoV to improve theMERS animal models. Incorporation of a SPECT/PET-compatible reporter gene with anemerging virus such as MERS-CoV requires functional evaluation of the recombinantvirus to ensure similar fitness to the parental pathogen. We hypothesized that insertionof hNIS would result in stable expression of a SPECT/PET-compatible reporter gene. Arecombinant MERS-CoV carrying hNIS (rMERS-CoV/hNIS) was generated. We assessedthe stability, fitness, and functionality of this recombinant pathogen in vitro and inCRISPR-generated transgenic mice that support replication of wild-type MERS-CoV (25).RESULTSrMERS-CoV/hNIS genetic stability, kinetics, and fitness. Recombinant virus wasevaluated by one-step and multistep kinetics and by serial passaging of the virus.rMERS-CoV/hNIS replicated similarly to rMERS-CoV in Vero E6 cells infected at a multi-Chefer et al.November/December 2018Volume 3Issue 6e00540-18msphere.asm.org2 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from plicity of infection (MOI) of 0.01 with a peak in virus yield of 4 log10plaque-formingunits (PFU)/ml at 24 h. At an MOI of 3, viral yields peaked at 7 log10PFU/ml at 48 h andplateaued at 72 h postinfection (Fig. 1a and b). The correlations between the multistepgrowth curves for cells infected at an MOI of 0.01 g (r ? 0.96 Pearson correlation,P ? 0.0082) (Fig. 1a) and one-step growth curves of cells infected at an MOI of 3(r ? 0.90, P ? 0.03) (Fig. 1b) for both viruses were high. Both viruses had comparablecytopathic effects (Fig. 1c and d).Expression of the hNIS transgene was evaluated by reverse transcriptase PCR(RT-PCR) using primers to specifically detect hNIS expression by MERS-CoV. The result-ing 635-bp PCR product includes the MERS-CoV leader sequence and a portion of thehNIS transgene. RT-PCR confirmed hNIS expression in rMERS-CoV/hNIS-infected Vero E6cells up to 96 h (Fig. 2a). The PCR product was not detected in parental rMERS-CoV-infected cells (Fig. 2b). The RT-PCR assay was also performed to determine the stabilityof the hNIS transgene following serial passage. The hNIS transgene was stable inrMERS-CoV/hNIS for up to six cell culture passages (Fig. 2c).hNIS functionality in MERS-CoV/hNIS-infected cells. To demonstrate in vitro hNISfunctionality, a series of assays were performed to characterize the kinetics of99mTc-pertechnetate cellular uptake, the relationship between virus concentration and probecellular uptake, and between probe dose and its detectability by the gamma camera.The in vitro hNIS functionality assay is outlined in Fig. 3a and b. The99mTc-pertechnetate uptake by rMERS-CoV/hNIS-infected cells in six-well plates was visible onthe tissue culture plate images and distinguishable from the background radioactivityin the wells with uninfected and rMERS-CoV-infected cells (Fig. 3c). In rMERS-CoV/hNIS-infected cells, uptake increased with time after infection and reached a maximum, 20%of the dose applied to the well, at the final 96-h postinfection time point (Fig. 4a). Themean radioactivity values measured in the wells were 89.8 ? 5.6, 0.77 ? 0.15, and0.57 ? 0.04?Ci for rMERS-CoV/hNIS-infected, rMERS-CoV-infected, and uninfected cells,respectively.FIG 1Kinetics of rMERS-CoV/hNIS and parental rMERS-CoV replication in Vero E6 cells. (a and b)Multistep (a) and one-step (b) growth curves of Vero E6 cells infected with rMERS-CoV (Parental) andrMERS-CoV/hNIS (hNIS). Quantification of the release of infectious virus at the indicated time points(hours postexposure) was determined by plaque assays. Each data point represents the mean ? standarddeviation (SD) (error bar) averaged from three independent experiments. (c and d) Cytopathology ofrMERS-CoV and rMERS-CoV/hNIS in Vero E6 cells. The cells were infected with either rMERS-CoV orrMERS-CoV/hNIS at an MOI of 0.01 (c) or 3 (d) and analyzed by light microscopy at the indicated timepoints. Photomicrographs were taken using a 40? objective.rMERS-CoV Expressing the Sodium Iodide SymporterNovember/December 2018Volume 3Issue 6e00540-18msphere.asm.org3 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from 99mTc-pertechnetate uptake was dependent on the virus MOI (Fig. 4b). Higher MOIwas associated with greater accumulation of99mTc-pertechnetate by rMERS-CoV/hNIS-infected cells.Uptake by rMERS-CoV/hNIS-infected cells was also dependent on the dose of99mTc-pertechnetate (Fig. 4c). The relationship between radioactivity measured by thegamma camera on plate images and the dose of99mTc-pertechnetate added to eachwell was linear with high correlation (R2? 0.99, linear regression). At 96 hourspostinfection with an MOI of 0.01, uptake was slightly above the background levelwhen the99mTc-pertechnetate dose of 0.02 mCi per well was applied, and no uptakewas detected when 0.004 mCi of99mTc-pertechnetate was added to each well (Fig. 4c).Therefore, the99mTc-pertechnetate dose should be considered a limiting factor fordetection of hNIS expression in rMERS-CoV/hNIS-infected cells. Importantly, no changesFIG 2 Retention of hNIS transgene following viral kinetics analysis and serial passage. (a and b) Vero E6 cells wereinfected with rMERS-CoV/hNIS (a) or parental rMERS-CoV (b) at an MOI of 0.01 or 3 and then collected at 96 hpostinfection for RT-PCR. (c) Retention of the hNIS gene following serial passage. RNA was extracted from cells 72h postinfection followed by RT-PCR at passage 6. A positive-control virus (C?) and uninfected negative-control cells(C?) were used as controls.FIG 3 Radio-uptake of99mTc-pertechnetate by planar scintigraphy. (a) Experimental overview of in vitroevaluation of the rMERS-CoV/hNIS virus. Vero E6 cells were infected with rMERS-CoV or rMERS-CoV/hNISat an MOI of 0.01 or 0.04. At various time points postinfection, the cells were incubated with99mTc-pertechnetate, and images of the plates were acquired. (b) Plate layout for hNIS functional assays. (c)Representative images of the plates acquired at 24 h postinfection at an MOI of 0.01 (top plates) or 0.04(bottom plates) after incubation with99mTc-pertechnetate.Chefer et al.November/December 2018Volume 3Issue 6e00540-18msphere.asm.org4 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from in99mTc-pertechnetate accumulation were detected in the wells infected with theparental virus rMERS-CoV regardless of the dose.The specificity of99mTc-pertechnetate uptake by rMERS-CoV/hNIS-infected cells wasconfirmed by adding sodium perchlorate, a specific and competitive inhibitor of hNISprotein function, and assessing uptake at 24 h postinfection (Fig. 5a). At a concentrationof 0.1 mM, sodium perchlorate blocked 99.5% of the cellular uptake of99mTc-pertechnetate in rMERS-CoV/hNIS-infected cells at an MOI of 0.01. Sodium perchlorateconcentrations below 0.1 mM reduced the inhibitory effect. For example, radiotraceruptake was inhibited by 50% at sodium perchlorate concentrations of 0.001 mM at 24h postinfection (Fig. 5a). The effective inhibition of99mTc-pertechnetate uptake with 0.1mM sodium perchlorate declined between 48 and 96 h postinfection (Fig. 5b), sug-gesting that viral transcription can overcome the inhibitory effect. By 96 h postinfec-FIG 4Quantification of99mTc-pertechnetate uptake by rMERS-CoV/hNIS-infected cells. (a)99mTc-pertechnetate uptake by rMERS-CoV- or rMERS-CoV/hNIS-infected cells at an MOI of 0.01 at 24, 48, 72,and 96 h postinfection. (b)99mTc-pertechnetate uptake by rMERS-CoV/hNIS-infected cells at an MOI of0.01 or 0.04 at 24 and 48 h postinfection. (c) Quantitative analysis of99mTc-pertechnetate uptake appliedat doses ranging from 0.6 to 0.004 mCi per well.FIG 5 Sodium perchlorate-mediated inhibition of99mTc-pertechnetate uptake. (a) Quantitation of99mTc-pertechnetate uptake in the presence of sodium perchlorate at doses ranging from 0 and 0.1 mM.99mTc-pertechnetate uptake was reduced in rMERS-CoV/hNIS-infected cells with increasing sodium per-chlorate concentrations. (b)99mTc-pertechnetate uptake by rMERS-CoV- or rMERS-CoV/hNIS-infected cells atan MOI of 0.01 at 24, 48, 72, and 96 h postinfection in the presence of 0.1 mM sodium perchlorate.rMERS-CoV Expressing the Sodium Iodide SymporterNovember/December 2018Volume 3Issue 6e00540-18msphere.asm.org5 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from tion,99mTc-pertechnetate uptake in rMERS-CoV/hNIS-infected cells was nearly doublethe uptake at 24 h postinfection in the presence of sodium perchlorate (Fig. 5b).In vivo evaluation of rMERS-CoV/hNIS. CRISPR-generated 288/330?/?DPP4 hu-manized mice were challenged with parental rMERS-CoV or rMERS-CoV/hNIS by theintranasal route and monitored by SPECT imaging. One group each of mice infectedwith rMERS-CoV/hNIS and parental rMERS-CoV were euthanized on day 3 postexposure(pe), while another set was monitored to day 7 pe and euthanized. SPECT/CT imagingwas performed to determine whether sites of virus replication were evident in theseanimals. Unfortunately, the low resolution of the clinical scanner used in our biocon-tainment facility prevented clear discrimination of hNIS-expressing tissues and limitedthe utility of the imaging. Details of the SPECT/CT data can be found in Fig. S1 and themethodology is described in Text S1 in the supplemental material.Macroscopic evaluation of the lungs from virus- and sham-exposed animals did notreveal any significant pathological changes except in one of the five mice in group 2(rMERS-CoV). The right caudodorsal lung lobe of this animal was congested. Micro-scopically, minimal-to-mild perivascular and peribronchiolar inflammation was notedmultifocally with variable congestion in rMERS-CoV- and rMERS-CoV/hNIS-infected mice(Fig. 6a to e). Kidney congestion was also noticeable in 40 and 50% of mice in groups2 and 3, respectively, on day 3 pe and 33 and 50% on day 7 pe in mice in groups 4 and5, respectively, infected with rMERS-CoV or rMERS-CoV/hNIS (Table 1). The percentageof mice with alterations in the lung was higher on day 7 pe compared to that observedon day 3 pe (100% vs ?83%, respectively). Extensive focal congestion in the lungs andmultifocal congestion in the kidneys were observed in one of five mice from group 1receiving sham infection, but inflammation was not manifested in this group (Table 1).Infectious virus could be detected only in the lungs from 3/6 mice from group 3(5.01 ? 0.45 log10PFU/mg) but was detected in the lung tissue by plaque assay in 4 of5 mice from group 2 (6.7 ? 0.43 log10mean ? SD PFU/mg) (Fig. 6f). The differencesin viral loads between groups 2 and 3 were not statistically significant (two-tailed t test,P ? 0.214). RT-PCR indicated maintenance of the hNIS transgene in 3 of 6 mice in group3 (Fig. 6g). The inability to detect virus in 3 of 6 mice and the nearly 2 log10decreasein PFU/mg observed for rMERS-CoV/hNIS at day 3 supports a loss of viral fitness in vivo.Virus could not be detected by plaque assay or RT-PCR at 7 days postinfection.DISCUSSIONThis is the first report describing the application of a recombinant RNA virusexpressing a SPECT/PET reporter gene to study viral pathogenesis. Our data demon-strate the feasibility of using hNIS as a reporter protein in animal models of humandisease, provided a higher-resolution SPECT/CT or PET/CT is available. Despite thepresence of a robust signal, the clinical grade SPECT/CT in our facility did not providethe necessary resolution to demonstrate in vivo functionality of the rMERS-CoV/hNIS inmice. If available, a micro-PET/CT and the use of tetrafluorborate, an alternate hNISligand, could be used to increase sensitivity and improve signal to noise (26). Therecombinant MERS-CoV/hNIS has similar fitness to the parental virus, rMERS-CoV, asevidenced by similar kinetics, fitness, and cytopathic effect in vitro. The results of in vivoevaluation also support similar fitness; however, further development would requireinsertion of the hNIS transgene into other locations within the virus and insertion of thetransgene into the MERS-15 virus, which can cause lethal respiratory disease in the288/300?mice.Genetic stability of the hNIS transgene cloned into MERS-CoV was confirmed over sixin vitro passages. hNIS maintained its function in rMERS-CoV/hNIS-infected cells uponincubation with99mTc-pertechnetate. The probe uptake (percentage of radioactivedose applied to each well) positively correlated with virus concentration and timepostinfection. rMERS-CoV/hNIS expression of the hNIS protein in infected Vero E6 cellsresulted in specific uptake of99mTc-pertechnetate and kinetics that correlated with viralreplication. Similarly, in a previous study using hNIS-expressing adenoviral vector inChefer et al.November/December 2018Volume 3Issue 6e00540-18msphere.asm.org6 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from carcinoma cells, radionuclide accumulation of99mTc-pertechnetate correlated with theamount of adenovirus delivered and the activity of the added radioisotope (27).Consistent with other studies (28), sodium perchlorate greatly decreased rMERS-CoV/hNIS uptake in cell culture. However, the sodium perchlorate dose that blockedhNIS protein function by 99.5% at 24 h postinfection became less effective at ?96 hpostinfection, corresponding with increased viral replication, and presumably sym-porter expression from the virus.These experiments utilized the 288/330?/?transgenic humanized mice (25). Resultsfrom previous work indicated that these mice, when challenged with the mouse-adapted MERS-15 virus, developed severe acute respiratory distress syndrome, includ-FIG 6 Lung histopathology in infected mice and detection of rMERS-CoV/hNIS or rMERS-CoV in lungtissue. (a to e) Histopathology of the lungs of one representative mouse each from groups 1, 2, 3, 4, and5 infected with rMERS-CoV or MERS-CoV/hNIS. The cells were visualized with HE stain. Magnification,?10. Bars ? 200?m. (a) Uninfected control mouse. (b) Representative mouse infected with rMERS-CoV(group 1) with multifocal, minimal-to-mild perivascular and peribronchiolar inflammation, with conges-tion on day 3 postexposure (pe). (c) Representative mouse infected with rMERS-CoV/hNIS (group 2) withmultifocal, minimal-to-mild perivascular and peribronchiolar inflammation, with congestion on day 3 pe.(d) Representative mouse infected with rMERS-CoV (group 4) with multifocal, minimal-to-mild perivas-cular and peribronchiolar inflammation with congestion at day 7 pe. (e) Representative mouse infectedwith rMERS-CoV/hNIS (group 5) with multifocal, minimal-to-mild perivascular and peribronchiolar in-flammation with congestion at day 7 pe. (f) Viral load in lung tissue on day 3 pe in mice infected withrMERS-CoV or rMERS-CoV/hNIS as determined by plaque assay. (g) RT-PCR analysis of the lungs recoveredfrom rMERS-CoV/hNIS- or rMERS-CoV-infected mice. The leftmost lane contains molecular size markers (inkilobases). The next three lanes contain stock controls, rMERS-CoV/hNIS (stock control, without RT step),rMERS-CoV stock, and rMERS-CoV/hNIS stock. C? indicates positive-control virus, and C? indictesuninfected negative-control cells. Samples from groups 1 to 5 are shown in the five sets of lanes asfollows: group 1, uninfected control (C?) group, lanes 1 to 5; group 2, exposed to rMERS-CoV, lanes 1to 5; group 3, exposed to rMERS-CoV/hNIS, lanes 1 to 6; group 4, exposed to rMERS-CoV, lanes 1 to 5;group 5, exposed to rMERS-CoV/hNIS, lanes 1 to 6. The asterisk in lane 5* of the rMERS-CoV/hNIS-treatedgroup on day 3 pe indicates altered PCR conditions (48C annealing temperature, 3% dimethyl sulfoxide)to improve the sensitivity to detect rMERS-CoV/hNIS.rMERS-CoV Expressing the Sodium Iodide SymporterNovember/December 2018Volume 3Issue 6e00540-18msphere.asm.org7 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from ing decreased survival, extreme weight loss, decreased pulmonary function, pulmonaryhemorrhage, and pathological signs indicative of end-stage lung disease (25). Similar tothe previously published work, the parental (MERS-CoV) and recombinant virus (MERS-CoV/hNIS) grew to high titers in the 288/330?/?mice, but the mice did not developdisease (25). Although the SPECT signal was dependent on the viral load in tissueculture, the SPECT signal from infected mice as determined by comparing lung-to-heartratios was not sufficiently different between infected and uninfected mice. Unfortu-nately, rMERS-CoV/hNIS was detected by PCR in only 50% of infected mice on day 3 pe,suggesting limited in vivo genetic stability.This inconsistent detection of rMERS-CoV/hNIS could be due to hNIS transgeneinsertion into the ORF5 gene, which antagonizes innate immunity and thus may impactviral pathogenesis in vivo (29). Cockrell et al. demonstrated that a clone of the MERS-15virus with an ORF5 deletion was attenuated compared to a clone in which the ORF5gene was not deleted (25). This attenuation may also explain the lower titer in therMERS-CoV/hNIS mice compared to that observed with the parental virus (Fig. 6f).Further utilization of hNIS as a reporter for virus growth and localization would includedeveloping the mouse-adapted version (rMERS-15/hNIS-CoV) for evaluation and modelimprovement and insertion of the hNIS into other locations of the viral genome.Imaging with a small-animal PET scanner and PET radiotracer18F-tetrafluoroboratewould improve image quality and sensitivity for visualizing rMERS-CoV/hNIS replication.An alternative to the SPECT is use of a gamma counter to measure the radioactivity inthe tissues; unfortunately, a suitable gamma counter is not available in our biosafetylevel 4 (BSL-4) laboratory. Alternatively, utilization of rMERS-CoV/hNIS in larger animals,i.e., nonhuman primates, should help overcome the SPECT clinical scanners limitedspatial resolution. This technology also aids identification of tissues that are directlyinfected, which would improve virological analysis, histological analysis, and charac-terization of tissue-specific response to infection.Although the animal models of MERS require further improvement, the modelchosen for this experiment was useful in supporting the relative in vivo stability of thehNIS reporter in MERS-CoV. The results from the mouse experiments agree withpublished studies (20, 21, 25) and corroborate previous data that indicate that wild-typevirus grows to a high titer in the 288/300?transgenic mice. Realizing the potentialand limitations of the existing MERS-CoV animal models, further incorporation ofreal-time imaging technology will expand MERS-CoV research. Development of recom-binant viruses with imaging reporter genes and its application with suitable animalmodels will be instrumental in furthering our understanding of viral pathogenesis,potentially leading to improved animal models of human disease and more efficientcountermeasure evaluation.MATERIALS AND METHODSCells, viruses, and animals. Recombinant parental virus (rMERS-CoV) and MERS-CoV expressing hNIS(rMERS-CoV/hNIS) were generated as previously described (30). Briefly, the hNIS open reading frame(ORF) was inserted into the NS5 ORF of MERS-CoV. The nine bases, UCCUUCAUA, between the M geneTRS and its start codon were included at the start of the hNIS sequence and cloned using the SanDIrestriction enzyme site upstream of ORF 6. Transfections for recovery of the recombinant viruses wereperformed at biosafety level 3 (BSL-3). Except for generation of the recombinant viruses, all experimentalTABLE 1 Pathological summary of miceMousegroup (n)RecombinantvirusDay of tissuesampling% mice in groupwith lunginflammation (n)% mice in groupwith congestion(n)MinimalMildLungKidneyGroup 1 (5)None (sham)70020 (1)20 (1)Group 2 (5)rMERS-CoV340 (2)40 (2)80 (4)40 (2)Group 3 (6)rMERS-CoV/hNIS333 (2)33 (2)83 (4)50 (3)Group 4 (6)rMERS-CoV733 (2)50 (3)100 (6)33 (2)Group 5 (6)rMERS-CoV/hNIS717 (1)67 (4)100 (6)50 (3)Chefer et al.November/December 2018Volume 3Issue 6e00540-18msphere.asm.org8 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from procedures were conducted at BSL-4 biocontainment laboratories due to the location of the SPECTclinical scanner. MERS-CoV isolate Hu/Jordan-N3/2012 was propagated in MRC-5 cells (ATCC) at amultiplicity of infection (MOI) of 0.1 for 5 days following published procedures (19, 31). Virus wasrecovered by removal of the tissue culture media followed by centrifugation, titers of the virus weredetermined by plaque assay, and the cultures were evaluated for mycoplasma and endotoxin contam-ination (19, 31). Vero E6 cells (ATCC CRL-1586) were maintained in Dulbeccos modified Eagle medium(DMEM) (Lonza) supplemented with 5% fetal bovine serum (FBS) and incubated at 37C and 5% CO2without antibiotics or antimycotics.CRISPR-Cas9-engineered mice (288/330?/?; n ? 30) encoding two amino acids (positions 288 and330) that match the human sequence in the DPP4 receptor on both chromosomes were obtained fromthe University of North Carolina (25).rMERS-CoV and rMERS-CoV/hNIS plaque assays. Plaque assays were performed in Vero E6 cells aspreviously described (32). For titration of virus in tissues, the collected tissues were homogenized usinga bead-based tissue homogenizer to make a 10% homogenate in DMEM plus 2% FBS (Sigma).One-step and multistep growth curves and serial passage. Kinetic studies with rMERS-CoV andrMERS-CoV/hNIS were performed in parallel experiments in triplicate. Vero E6 cells were infected withrMERS-CoV or rMERS-CoV/hNIS at an MOI of 0.01 or 3. Samples were collected at 0, 24, 36, 48, 72, and96 h postinfection, and virus titers were determined as described above. Serial passage was performedto demonstrate stability of the hNIS transgene. Virus was passaged every 72 h for six passages. An aliquotwas collected and assayed by reverse transcriptase PCR (RT-PCR) to detect the hNIS transgene.RT-PCR of viral RNA. For evaluation of stability of the hNIS gene, total RNA was isolated from VeroE6 cells collected 24, 36, 48, 72, and 96 h after rMERS-CoV and rMERS-CoV/hNIS infection at MOIs of 0.01and 3. The RNA was reverse transcribed into cDNA using deoxythymidine oligonucleotide primers andSuperScript reverse transcriptase II (Thermo Fisher Scientific) according to the manufacturers protocol.Two custom primers, hNIS Leader (forward primer sequence, 5=CTATCTCACTTCCCCTCGTTCTC) with hNIS6(reverse primer sequence, 5=GAAGCCACTTAGCATCAC) were used to create PCR products. PCR productswere separated and identified on a SYBR safe DNA-stained agarose gel (Thermo Fisher Scientific). StockrMERS-CoV/hNIS was used as a positive control, and uninfected-cell lysates were used as a negativecontrol for RT-PCR.Cell culture radio-uptake assay. Functionality of the hNIS gene was assessed by hNIS-mediatedaccumulation of99mTc-pertechnetate by rMERS-CoV/hNIS-infected cells. Vero E6 cells were infected withrMERS-CoV or rMERS-CoV/hNIS at two different MOIs, 0.01 and 0.004, and incubated for 0, 24, 36, 48, 72,and 96 h.99mTc-pertechnetate, 0.004 to 0.6 mCi in 0.2 ml, was added to each well and incubated for 60min.99mTc-pertechnetate was removed from the wells, and the cells were washed with room temper-ature media. Planar images of the plates were acquired over 30 min with a single gamma camera headusing the Precedence SPECT/computed tomography (CT) clinical system (Philips Medical Systems), thatwas modified to operate in a biocontainment environment (33). The in vitro samples were quantifiedusing the SPECT/CT scanner. Uninfected cells were treated with99mTc-pertechnetate to determine thebackground level. Specificity of99mTc-pertechnetate uptake by rMERS-CoV/hNIS-infected cells wasassessed by adding sodium perchlorate, NaClO4, 1 to 100?M, to the wells prior to99mTc-pertechnetateintroduction.99mTc-pertechnetate counts from each well were converted into radioactivity units anddecay-corrected relative to the time of probe introduction to the wells. Uptake of99mTc-pertechnetateby infected cells was expressed as a percentage of the radioactive dose applied to the well. Theradio-uptake assays were conducted in triplicate.Transgenic mouse experiments. Thirty 288/330?/?mice, 15 males and 15 females, were split into5 groups of 6 animals. Two mice, one from group 1 and one from group 4, did not recover fromanesthesia after a preexposure scan and were not replaced. Mice were lightly anesthetized withisoflurane and were exposed intranasally with phosphate-buffered saline (PBS) without virus (group 1) orwith rMERS-CoV (groups 2 and 4) or rMERS-CoV/hNIS (groups 3 and 5). The virus/PBS was instilled intoboth nostrils, 25?l per nostril. The mice were monitored daily for clinical signs of disease. The animalsfrom groups 2 and 3 were euthanized on day 3 postexposure (pe), and the animals from groups 1, 4, and5 were euthanized on day 7 pe. The lungs were collected for gross pathological and microscopicevaluation and virus detection via plaque assay.Ethics statement. All work with animals was performed in an AAALAC-accredited research facilityand approved by the National Institute for Allergy and Infectious Disease Division of Clinical ResearchAnimal Care and Use Committee. The experiments complied with the Animal Welfare Act regulations,Public Health Service policy, and the Guide for the Care and Use of Laboratory Animals (34). Animals weremonitored daily. Clinical health, body weight, and food consumption were recorded.Statistical analysis. Statistical analysis was performed using Graphpad Prism 7.03 (Graphpad Soft-ware Inc.) as indicated in the text.SUPPLEMENTAL MATERIALSupplemental material for this article may be found at https:/doi.org/10.1128/mSphere.00540-18.TEXT S1, DOCX file, 0.01 MB.FIG S1, TIF file, 2.1 MB.rMERS-CoV Expressing the Sodium Iodide SymporterNovember/December 2018Volume 3Issue 6e00540-18msphere.asm.org9 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from ACKNOWLEDGMENTSWe thank Russell Byrum, Danny Ragland, and Marisa St. Claire and the entire IRFComparative Medicine and Imaging staff for successful implementation of SPECTscanning procedures in mice in the biosafety level 4 environment. We thank LauraBollinger for critically editing the manuscript and Jiro Wada for figure development. Wealso thank Matthias Schnell, Thomas Jefferson University, for his critical review of themanuscript.This work was funded in part through the NIAID Division of Intramural Research andthe NIAID Division of Clinical Research, Battelle Memorial Institutes prime contract withthe U.S. National Institute of Allergy and Infectious Diseases (NIAID) under contractHHSN272200700016I and an NIH grant in aid to R.S.B. (AI110700 and AI132178). K.R.H.,J.K.B., and M.R.H. performed this work as employees of Battelle Memorial Institute.Subcontractors to Battelle Memorial Institute who performed this work are as follows:S.C., D.T., E.P., and J.D., all employees of Tunnell Government Services, Inc.; M.G.L., anemployee of Lovelace Respiratory Research Institute; C.B. and P.J.S., employees ofMedRelief; D.L., an employee of Charles River Laboratories.S.C., C.B., P.J.S., J.D., D.X.L., L.M.H., E.P., J.K.B., A.E.-F., M.G.L., K.C., M.R.K., and J.S.performed experiments and analyzed data. A.S., R.S.B., B.Y., and A.S.C. provided 288-330?/?mice and reagents and generated the recombinant viruses. S.C., K.R.H., M.R.K.,M.R.H., D.T., P.B.J., and R.F.J. designed experiments. S.C. and R.F.J. wrote the manuscript.All authors read and edited the manuscript.We declare that we have no competing financial interests.The content of this publication does not necessarily reflect the views or policies ofthe U.S. Department of Health and Human Services (DHHS) or of the institutions andcompanies affiliated with the authors.REFERENCES1. Hoenen T, Groseth A, Callison J, Takada A, Feldmann H. 2013. A novelEbola virus expressing luciferase allows for rapid and quantitative test-ing of antivirals. Antiviral Res 99:207213. https:/doi.org/10.1016/j.antiviral.2013.05.017.2. Marsh GA, Virtue ER, Smith I, Todd S, Arkinstall R, Frazer L, Monaghan P,Smith GA, Broder CC, Middleton D, Wang LF. 2013. Recombinant Hendraviruses expressing a reporter gene retain pathogenicity in ferrets. Virol J10:95. https:/doi.org/10.1186/1743-422X-10-95.3. Rennick LJ, de Vries RD, Carsillo TJ, Lemon K, van Amerongen G, LudlowM, Nguyen DT, Yuksel S, Verburgh RJ, Haddock P, McQuaid S, DuprexWP, de Swart RL. 2015. Live-attenuated measles virus vaccine targetsdendritic cells and macrophages in muscle of nonhuman primates. JVirol 89:21922200. https:/doi.org/10.1128/JVI.02924-14.4. Rozelle DK, Filone CM, Dower K, Connor JH. 2014. Vaccinia reporterviruses for quantifying viral function at all stages of gene expression. JVis Exp 15:e51522.5. Altenburg AF, van de Sandt CE, Li BWS, MacLoughlin RJ, Fouchier RAM,van Amerongen G, Volz A, Hendriks RW, de Swart RL, Sutter G, Rimmel-zwaan GF, de Vries RD. 2017. Modified vaccinia virus Ankara preferen-tially targets antigen presenting cells in vitro, ex vivo and in vivo. Sci Rep7:8580. https:/doi.org/10.1038/s41598-017-08719-y.6. Goff A, Twenhafel N, Garrison A, Mucker E, Lawler J, Paragas J. 2007. Invivo imaging of cidofovir treatment of cowpox virus infection. Virus Res128:8898. https:/doi.org/10.1016/j.virusres.2007.04.014.7. Kato SI, Nagata K, Takeuchi K. 2012. Cell tropism and pathogenesis ofmeasles virus in monkeys. Front Microbiol 3:14. https:/doi.org/10.3389/fmicb.2012.00014.8. Ahn BC. 2012. Sodium iodide symporter for nuclear molecular imagingand gene therapy: from bedside to bench and back. Theranostics2:392402. https:/doi.org/10.7150/thno.3722.9. Penheiter AR, Russell SJ, Carlson SK. 2012. The sodium iodide symporter(NIS) as an imaging reporter for gene, viral, and cell-based therapies. CurrGene Ther 12:3347. https:/doi.org/10.2174/156652312799789235.10. Dohan O, Carrasco N. 2003. Advances in Na(?)/I(-) symporter (NIS)research in the thyroid and beyond. Mol Cell Endocrinol 213:5970.https:/doi.org/10.1016/j.mce.2003.10.059.11. Haddad D, Chen NG, Zhang Q, Chen CH, Yu YA, Gonzalez L, CarpenterSG, Carson J, Au J, Mittra A, Gonen M, Zanzonico PB, Fong Y, Szalay AA.2011. Insertion of the human sodium iodide symporter to facilitate deeptissue imaging does not alter oncolytic or replication capability of anovel vaccinia virus. J Transl Med 9:36. https:/doi.org/10.1186/1479-5876-9-36.12. Kang JH, Chung JK. 2008. Molecular-genetic imaging based on reportergene expression. J Nucl Med 49(Suppl 2):164S179S. https:/doi.org/10.2967/jnumed.107.045955.13. Sun C, Gardner CL, Watson AM, Ryman KD, Klimstra WB. 2014. Stable,high-level expression of reporter proteins from improved alphavirusexpression vectors to track replication and dissemination during en-cephalitic and arthritogenic disease. J Virol 88:20352046. https:/doi.org/10.1128/JVI.02990-13.14. Assiri A, McGeer A, Perl TM, Price CS, Al Rabeeah AA, Cummings DA,Alabdullatif ZN, Assad M, Almulhim A, Makhdoom H, Madani H,Alhakeem R, Al-Tawfiq JA, Cotten M, Watson SJ, Kellam P, Zumla AI,Memish ZA. 2013. Hospital outbreak of Middle East respiratory syn-drome coronavirus. N Engl J Med 369:407416. https:/doi.org/10.1056/NEJMoa1306742.15. Guery B, Poissy J, el Mansouf L, Sejourne C, Ettahar N, Lemaire X, VuottoF, Goffard A, Behillil S, Enouf V, Caro V, Mailles A, Che D, Manuguerra JC,Mathieu D, Fontanet A, van der Werf S. 2013. Clinical features and viraldiagnosis of two cases of infection with Middle East Respiratory Syn-drome coronavirus: a report of nosocomial transmission. Lancet 381:22652272. https:/doi.org/10.1016/S0140-6736(13)60982-4.16. Bhatia PK, Sethi P, Gupta N, Biyani G. 2016. Middle East respiratorysyndrome: a new global threat. Indian J Anaesth 60:8588. https:/doi.org/10.4103/0019-5049.176286.17. de Wit E, Rasmussen AL, Falzarano D, Bushmaker T, Feldmann F, BriningDL, Fischer ER, Martellaro C, Okumura A, Chang J, Scott D, Benecke AG,Katze MG, Feldmann H, Munster VJ. 2013. Middle East respiratory syn-drome coronavirus (MERS-CoV) causes transient lower respiratory tractinfection in rhesus macaques. Proc Natl Acad Sci U S A 110:1659816603. https:/doi.org/10.1073/pnas.1310744110.18. Yao Y, Bao L, Deng W, Xu L, Li F, Lv Q, Yu P, Chen T, Xu Y, Zhu H, YuanChefer et al.November/December 2018Volume 3Issue 6e00540-18msphere.asm.org10 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from J, Gu S, Wei Q, Chen H, Yuen KY, Qin C. 2014. An animal model of MERSproduced by infection of rhesus macaques with MERS coronavirus. JInfect Dis 209:236242. https:/doi.org/10.1093/infdis/jit590.19. Johnson RF, Via LE, Kumar MR, Cornish JP, Yellayi S, Huzella L, PostnikovaE, Oberlander N, Bartos C, Ork BL, Mazur S, Allan C, Holbrook MR,Solomon J, Johnson JC, Pickel J, Hensley LE, Jahrling PB. 2015. Intratra-cheal exposure of common marmosets to MERS-CoV Jordan-n3/2012 orMERS-CoV EMC/2012 isolates does not result in lethal disease. Virology485:422430. https:/doi.org/10.1016/j.virol.2015.07.013.20. Haagmans BL, van den Brand JM, Provacia LB, Raj VS, Stittelaar KJ, GetuS, de Waal L, Bestebroer TM, van Amerongen G, Verjans GM, Fouchier RA,Smits SL, Kuiken T, Osterhaus AD. 2015. Asymptomatic Middle Eastrespiratory syndrome coronavirus infection in rabbits. J Virol 89:61316135. https:/doi.org/10.1128/JVI.00661-15.21. Houser KV, Gretebeck L, Ying T, Wang Y, Vogel L, Lamirande EW, BockKW, Moore IN, Dimitrov DS, Subbarao K. 2016. Prophylaxis with a MiddleEast respiratory syndrome coronavirus (MERS-CoV)-specific humanmonoclonal antibody protects rabbits from MERS-CoV infection. J InfectDis 213:15571561. https:/doi.org/10.1093/infdis/jiw080.22. Agrawal AS, Garron T, Tao X, Peng BH, Wakamiya M, Chan TS, Couch RB,Tseng CT. 2015. Generation of a transgenic mouse model of Middle Eastrespiratory syndrome coronavirus infection and disease. J Virol 89:36593670. https:/doi.org/10.1128/JVI.03427-14.23. Pascal KE, Coleman CM, Mujica AO, Kamat V, Badithe A, Fairhurst J, HuntC, Strein J, Berrebi A, Sisk JM, Matthews KL, Babb R, Chen G, Lai KM,Huang TT, Olson W, Yancopoulos GD, Stahl N, Frieman MB, Kyratsous CA.2015. Pre- and postexposure efficacy of fully human antibodies againstSpike protein in a novel humanized mouse model of MERS-CoV infec-tion. Proc Natl Acad Sci U S A 112:87388743. https:/doi.org/10.1073/pnas.1510830112.24. Zhao J, Li K, Wohlford-Lenane C, Agnihothram SS, Fett C, Zhao J, GaleMJ, Jr, Baric RS, Enjuanes L, Gallagher T, McCray PB, Jr, Perlman S. 2014.Rapid generation of a mouse model for Middle East respiratory syn-drome. Proc Natl Acad Sci U S A 111:49704975. https:/doi.org/10.1073/pnas.1323279111.25. Cockrell AS, Yount BL, Scobey T, Jensen K, Douglas M, Beall A, Tang XC,Marasco WA, Heise MT, Baric RS. 2016. A mouse model for MERScoronavirus-induced acute respiratory distress syndrome. Nat Microbiol2:16226. https:/doi.org/10.1038/nmicrobiol.2016.226.26. Khoshnevisan A, Jauregui-Osoro M, Shaw K, Torres JB, Young JD, Ra-makrishnan NK, Jackson A, Smith GE, Gee AD, Blower PJ. 2016. (18)Ftet-rafluoroborate as a PET tracer for the sodium/iodide symporter: theimportance of specific activity. EJNMMI Res 6:34. https:/doi.org/10.1186/s13550-016-0188-5.27. Niu G, Gaut AW, Ponto LL, Hichwa RD, Madsen MT, Graham MM,Domann FE. 2004. Multimodality noninvasive imaging of gene transferusing the human sodium iodide symporter. J Nucl Med 45:445449.28. Zuckier LS, Dohan O, Li Y, Chang CJ, Carrasco N, Dadachova E, Dohan O.2004. Kinetics of perrhenate uptake and comparative biodistribution ofperrhenate, pertechnetate, and iodide by NaI symporter-expressing tis-sues in vivo. J Nucl Med 45:500507.29. Menachery VD, Mitchell HD, Cockrell AS, Gralinski LE, Yount BL, Jr,Graham RL, McAnarney ET, Douglas MG, Scobey T, Beall A, Dinnon K, III,Kocher JF, Hale AE, Stratton KG, Waters KM, Baric RS. 2017. MERS-CoVaccessory ORFs play key role for infection and pathogenesis. mBio8:e00665-17. https:/doi.org/10.1128/mBio.00665-17.30. Scobey T, Yount BL, Sims AC, Donaldson EF, Agnihothram SS, MenacheryVD, Graham RL, Swanstrom J, Bove PF, Kim JD, Grego S, Randell SH, BaricRS. 2013. Reverse genetics with a full-length infectious cDNA of theMiddle East respiratory syndrome coronavirus. Proc Natl Acad Sci U S A110:1615716162. https:/doi.org/10.1073/pnas.1311542110.31. Johnson RF, Bagci U, Keith L, Tang X, Mollura DJ, Zeitlin L, Qin J,Huzella L, Bartos CJ, Bohorova N, Bohorov O, Goodman C, Kim DH,Paulty MH, Velasco J, Whaley KJ, Johnson JC, Pettitt J, Ork BL,Solomon J, Oberlander N, Zhu Q, Sun J, Holbrook MR, Olinger GG,Baric RS, Hensley LE, Jahrling PB, Marasco WA. 2016. 3B11-N, amonoclonal antibody against MERS-CoV, reduces lung pathology inrhesus monkeys following intratracheal inoculation of MERS-CoVJordan-n3/2012. Virology 490:4958. https:/doi.org/10.1016/j.virol.2016.01.004.32. Kumar M, Mazur S, Ork BL, Postnikova E, Hensley LE, Jahrling PB, JohnsonR, Holbrook MR. 2015. Inactivation and safety testing of Middle EastRespiratory Syndrome Coronavirus. J Virol Methods 223:1318. https:/doi.org/10.1016/j.jviromet.2015.07.002.33. de Kok Mercado F, Kutlak F, Jahrling PB. 2011. The NIAID IntegratedResearch Facility at Fort Detrick. Appl Biosaf 16:5866. https:/doi.org/10.1177/153567601101600202.34. National Research Council. 2011. Guide for the care and use of labora-tory animals, 8th ed. National Academies Press, Washington, DC.rMERS-CoV Expressing the Sodium Iodide SymporterNovember/December 2018Volume 3Issue 6e00540-18msphere.asm.org11 on March 11, 2019 by guesthttp:/msphere.asm.org/Downloaded from