JOURNAL OFVIROLOGY, Dec. 2004, p. 1405714061Vol. 78, No. 240022-538X/04/$08.00?0DOI: 10.1128/JVI.78.24.1405714061.2004Copyright 2004, American Society for Microbiology. All Rights Reserved.Genetic Screen for Monitoring Severe Acute Respiratory SyndromeCoronavirus 3C-Like ProteaseMariona Parera, Bonaventura Clotet, and Miguel Angel Martinez*Fundacio irsiCaixa, Hospital Universitari Germans Trias i Pujol, Badalona, SpainReceived 30 April 2004/Accepted 3 August 2004A novel coronavirus (SCoV) is the etiological agent of severe acute respiratory syndrome. Site-specificproteolysis plays a critical role in regulating a number of cellular and viral processes. Since the main proteaseof SCoV, also termed 3C-like protease, is an attractive target for drug therapy, we have developed a safe,simple, and rapid genetic screen assay to monitor the activity of the SCoV 3C-like protease. This genetic systemis based on the bacteriophage lambda regulatory circuit, in which the viral repressor cI is specifically cleavedto initiate the lysogenic-to-lytic switch. A specific target for the SCoV 3C-like protease, P1/P2 (SAVLQ/SGFRK), was inserted into the lambda phage cI repressor. The target specificity of the SCoV P1/P2 repressor wasevaluated by coexpression of this repressor with a chemically synthesized SCoV 3C-like protease gene con-struct. Upon infection of Escherichia coli cells containing the two plasmids encoding the cI. SCoV P1/P2-cro andthe ?-galactosidaseSCoV 3C-like protease constructs, lambda phage replicated up to 2,000-fold more effi-ciently than in cells that did not express the SCoV 3C-like protease. This simple and highly specific assay canbe used to monitor the activity of the SCoV 3C-like protease, and it has the potential to be used for screeningspecific inhibitors.The recently identified severe acute respiratory syndrome(SARS) coronavirus (CoV) (SCoV) (5, 9, 12, 19) causes alife-threatening highly contagious pneumonia and is the mostpathogenic human CoV identified so far. This disease was firstrecognized in southern China in November 2002. By August2003, 8,422 cases had occurred in 29 countries and 908 indi-viduals had died from the disease (http:/www.who.int/csr/sars/country/en/country2003_08_15.pdf). Its rapid transmissionand the high mortality (10%) make SARS a potential globalthreat. Recent reports of several SARS cases show that newSARS outbreaks are possible in the near future (http:/www-.who.int/csr/don/en/). To date, neither a vaccine nor an effec-tive therapy is available.The activity of specific proteases is essential in many funda-mental cellular and viral processes. Viral polyprotein process-ing is indispensable in the replication and maturation of manyviruses (6). Consequently, site-specific proteolysis has been anattractive target for the development of antiviral therapiesbased on potent and selective viral inhibitors. The generationof such therapies based on the inhibition of site-specific pro-teolysis has been clearly illustrated in the development of ef-fective inhibitors of human immunodeficiency virus type 1(HIV-1) (10, 30) and hepatitis C virus (HCV) (13).CoVs are large, enveloped, plus-strand RNA viruses, whichhave the largest genomes of all RNA viruses (11). The SCoVgenomic RNA is nearly 30 kb and is capped and polyadenyl-ated (14, 21, 22). The primary translation product of the viralRNA is largely processed into multiple proteins by the viralmain protease, also called 3C-like protease (Fig. 1) to indicatethe similarity of its cleavage site specificity to that observed forpicornavirus 3C protease (1). The SCoV 3C-like protease hasa molecular mass of nearly 35 kDa (7, 24, 31) and, like otherCoV 3C-like proteases, has specificity for Gln at the P1 posi-tion (2). Recently, the crystal structure of the SCoV 3C-likeprotease has revealed that the protein fold can be described asa serine protease, but with a Cys-His at the active site (31).It has been demonstrated that a bacteriophage lambda-based genetic screen can be used to isolate and characterizesite-specific proteases (25). We have previously adapted thissystem, illustrated in Fig. 2, to study the HIV-1 and HCVproteases (3, 15, 16). This genetic screen system is based on thebacteriophage lambda cI-cro regulatory circuit, where the ?-* Corresponding author. Mailing address: Fundacio irsiCaixa, Hos-pital Universitari Germans Trias i Pujol, 08916 Badalona, Spain.Phone: 34-934656374. Fax: 34-934653968. E-mail: miguelvilassaryahoo.es.FIG. 1. Amino acid sequence of the SCoV 3C-like protease engi-neered in the present study. The autocleavage sites of the protease aremarked with vertical arrows above the sequences. The cleavage siteused as a target site in the genetic screen described here is shaded.Underlined are the catalytic-site residues Cys145 and His41.14057 on June 4, 2015 by FLORIDA INTL UNIV/GL810http:/jvi.asm.org/Downloaded from encoded repressor cI is specifically cleaved to initiate the lyso-genic-to-lytic switch (20). The inherent difficulties and safetyrequirements for the ex vivo propagation of SCoV promptedus to explore this genetic system as a simple alternative ap-proach for the characterization of SCoV 3C-like protease ac-tivity. In this report, we demonstrate that the lambda-basedgenetic screen system can be used to monitor the activity of theSCoV 3C-like protease.We chemically synthesized the SCoV 3C-like protease gene(Fig. 1) from synthetic oligonucleotides as chemical buildingblocks without employing any viral component formed in vivoor ex vivo (4, 27). The strategy of synthesizing the SCoV 3C-like protease was as follows. Three overlapping DNA frag-ments of 340, 340, and 268 bp were combined by PCR, usingthe Overlap Extension protocol (23), to obtain the full-lengthSCoV 3C-like protease. Each of the former DNA fragmentswas synthesized by assembling eight purified oligonucleotides(average length, 60 nucleotides nt) of plus and minus polar-ities with an overlapping complementary sequence of 20 nt attheir termini (Table 1). Synthetic oligonucleotides were assem-bled in an asymmetric PCR assay previously described (18) andwere designed to synthesize the SCoV 3C-like protease geneFIG. 2. Lambda-based genetic screen to monitor the activity of SCoV 3C-like protease. This genetic screen system is based on the bacterio-phage lambda cI-cro regulatory circuit, where the viral repressor cI is specifically cleaved to initiate the lysogenic-to-lytic switch. (A) Expressionof the phage-encoded repressor (cI) results in repression of the bacteriophages lytic functions (lysogeny). (B) SCoV target repressor containingthe P1/P2 cleavage site; as illustrated in Fig. 3 and 4, this repressor efficiently represses the infecting phage (lysogeny). (C) When phages infectE. coli cells that express recombinant cI.SCoV repressor and ?-GalSCoV 3C-like protease, infection results in lytic replication.TABLE 1. Synthetic oligonucleotides for engineering the full-length SCoV 3C-like protease used in this workNameSequence (5?3?)ntaOrientationS1TCTGCTGTTCTGCAGAGTGGTTTTAGGAAAATGGCATTCCCGTCAGGCAAAGTTGAAGGG?1545SenseS2CATTAAGAGTTGTAGTTCCACAGGTTACTTGTACCATGCACCCTTCAACTTTGCCTGACG2685AntisenseS3TGGAACTACAACTCTTAATGGATTGTGGTTGGATGACACAGTATACTGTCCAAGACATGT66125SenseS4TTCATAGTTAGGATTAAGCATGTCTTCTGCTGTGCAAATGACATGTCTTGGACAGTATAC106165AntisenseS5TGCTTAATCCTAACTATGAAGATCTGCTCATTCGCAAATCCAACCATAGCTTTCTTGTTC146205SenseS6ATAGAATGGCCAATAACACGAAGTTGAACATTGCCAGCCTGAACAAGAAAGCTATGGTTG186245AntisenseS7CGTGTTATTGGCCATTCTATGCAAAATTGTCTGCTTAGGCTTAAAGTTGATACTTCTAAC226285SenseS8CAGGTTGGATACGGACAAATTTATACTTGGGTGTCTTAGGGTTAGAAGTATCAACTTTAA266325AntisenseS9ATTTGTCCGTATCCAACCTGGTCAAACATTTTCAGTTCTAGCATGCTACAATGGTTCACC306365SenseS10GGTATGATTAGGTCTCATGGCACACTGATAAACACCAGATGGTGAACCATTGTAGCATGC346405AntisenseS11CCATGAGACCTAATCATACCATTAAAGGTTCTTTCCTTAATGGATCATGTGGTAGTGTTG386445SenseS12ATATAGCAGAAAGACACGCAATCATAATCAATGTTAAAACCAACACTACCACATGATCCA426485AntisenseS13TGCGTGTCTTTCTGCTATATGCATCATATGGAGCTTCCAACAGGAGTACACGCTGGTACT466525SenseS14GTCTGTCAACAAATGGACCATAGAATTTACCTTCTAAGTCAGTACCAGCGTGTACTCCTG506565AntisenseS15TGGTCCATTTGTTGACAGACAAACTGCACAGGCTGCAGGTACAGACACAACCATAACATT546605SenseS16ACCATTGATAACAGCAGCATACAGCCATGCCAAAACATTTAATGTTATGGTTGTGTCTGT586645AntisenseS17ATGCTGCTGTTATCAATGGTGATAGGTGGTTTCTTAATAGATTCACCACTACTTTGAATG626685SenseS18AAAGGTTCATAGTTGTACTTCATTGCCACAAGGTTAAAGTCATTCAAAGTAGTGGTGAAT666725AntisenseS19AAGTACAACTATGAACCTTTGACACAAGATCATGTTGACATATTGGGACCTCTTTCTGCT706766SenseS20TCAAAGCAGCACACATATCTAAGACGGCAATTCCTGTTTGAGCAGAAAGAGGTCCCAATA746805AntisenseS21AGATATGTGTGCTGCTTTGAAAGAGCTGCTGCAGAATGGTATGAATGGTCGTACTATCCT786845SenseS22ATCAAATGGTGTAAACTCATCTTCTAAAATAGTGCTACCAAGGATAGTACGACCATTCAT826885AntisenseS23ATGAGTTTACACCATTTGATGTTGTTAGACAATGCTCTGGTGTTACCTTCCAAGGTAAGTTCAAGAAA866948SenseSProRGGGAGGGGGCTCGAGTCATTTCTTGAACTTACCTTGb916948AntisenseaNumerical position on the SCoV 3C-like protease.bUnderlining indicates an XhoI restriction site.14058NOTESJ. VIROL. on June 4, 2015 by FLORIDA INTL UNIV/GL810http:/jvi.asm.org/Downloaded from reported by Anand et al. (2). Next, the full-length SCoV 3C-like protease gene was reamplified by PCR with oligonucleo-tides SProL (sense, 5?GGGTTGAATTCTGCTGTTCTGCAGAGT 3?; underlining indicates an EcoRI restriction site) andSProR (antisense; Table 1), digested with EcoRI and XhoI,and cloned into pBluescript SK(?) (pBSK?; Stratagene) togenerate the ?-galactosidase (?-Gal)SCoV 3C-like proteasefusion (Fig. 2). Sequence analysis of several full-length ?-GalSCoV 3C-like protease clones verified the accuracy of thesesynthetic genes. One of the former clones had exactly the in-tended sequence (Fig. 1).By using a unique restriction site (BssH2 site) located in thecoding sequence of the linker domain of cI (25), the SCoV3C-like protease P1/P2 (SAVLQ/SGFRK) cleavage site was in-serted into the ? cI repressor (cI.SCoV) (Fig. 2B). The oligo-nucleotides encoding the SCoV proteolytic P1/P2 cleavage sitewere 5?GTTCAGGCGCGCGCTTCAATCACTTCTGCTGTTCTGCAGAGTGGTTTTAGGAAAATGGCATTCGCGCGCATGTTC3? (sense) and 5?GAACATGCGCGCGAATGCCATTTTCCTAAAACCACTCTGCAGAACAGCAGAAGTGATTGAAGCGCGCGCCTGAAC3? (antisense). A controlmutant site (SAVLA/SGFRK) was also inserted in the ? cI re-pressor (cI.SCoVmt). As illustrated (Fig. 3), Escherichia coliJM109 cells expressing these two repressors efficiently re-pressed the infecting phage.We next tested the target specificity of the SCoV repressorsby coexpressing these repressors with a ?-GalSCoV 3C-likeprotease fusion construct. E. coli JM109 cells were then co-transformed with plasmids encoding the cI.SCoV repressorand the ?-GalSCoV 3C-like protease constructs (Fig. 2C).The resulting cells were grown overnight at 30C in the pres-ence of 0.2% maltose, harvested by centrifugation, and resus-pended to an optical density at 600 nm (OD600) of 2.0 per mlin 10 mM MgSO4. To induce the expression of SCoV 3C-likeprotease, cells (200 ?l) were incubated in 1 ml of Luria-Bertani(LB) medium containing 12.5 ?g of tetracycline, 20 ?g ofampicillin, 0.2% maltose, 10 mM MgSO4, and 1 mM IPTG(isopropyl-?-D-thiogalactopyranoside) for 1 h. Thereafter, cellcultures were infected with 107PFU of ? phage. After 3 h at37C, the titer of the resulting phage was determined by co-plating the cultures with 200 ?l of E. coli XL-1 Blue cells(OD600? 2.0/ml in 10 mM MgSO4) on LB plates using 3 ml oftop agar containing 12.5 ?g of tetracycline per ml, 0.2% mal-tose, and 0.1 mM IPTG. After incubation at 37C for 6 h, theresulting phage plaques were counted for growth scores. Asshown in Fig. 3, ? phage replicated up to 2,000-fold moreefficiently in cells expressing the cI.SCoV repressor and the?-GalSCoV 3C-like protease than in cells that did not expressthe ?-GalSCoV 3C-like protease (Fig. 3).The specificity of this trans-cleavage reaction was furtherdemonstrated by the lack of phage replication in cells express-ing mutated forms of the SCoV 3C-like protease that includedcatalytic-site residue substitutions C145A and H41A (Fig. 3).To demonstrate that the engineered cI.SCoV repressor ishighly specific for the SCoV 3C-like protease, cells expressingthe cI.SCoV repressor were transformed with an HCV serineprotease construct. As shown in Fig. 3, the expression of theHCV serine protease did not allow phage replication. Like-wise, phage replication was also abolished in cells expressingthe control cI.SCoVmt repressor, arguing that cI.SCoV degra-dation was specifically mediated by the SCoV 3C-like protease.Finally, a Western blot also demonstrated (Fig. 4) that theexpression of the SCoV 3C-like protease resulted in nearlycomplete cleavage of the cI.SCoV repressor (Fig. 4, lane 1) buthad no effect on the control cI.SCoVmt (Fig. 4, lane 4). Ex-pression of proteases that included catalytic-site residue sub-stitutions C145A and H41A (Fig. 4, lanes 6 and 5, respectively)completely abolished the cleavage of cI.SCoV. Furthermore,expression of another protease as the HCV serine proteasealso abolished wild-type cI.SCoV repressor cleavage (Fig. 4,lane 8).The genetic screen system used here to monitor the activityof the SCoV 3C-like protease is based on the well-character-ized bacteriophage ? lytic-lysogenic cycle (20). When the cIrepressor is functional, lytic gene products are silenced and thephage enters a lysogenic phase. Endogenous bacterial proteaseRecA cleaves the cI repressor at a specific region. cI repressorcleavage allows the expression of cro and progression into thelytic replication cycle. This lysogenic-to-lytic switch was previ-ously adapted to develop a genetic screen system for the char-acterization of the HIV-1 and HCV proteases (3, 15, 16, 25,26). The simplicity and specificity of this system prompted us toexplore this genetic system as a new approach for the charac-FIG. 3. Selective growth of ? in E. coli cells coexpressing the?-GalSCoV 3C-like protease construct and the cI.SCoV repressor.Expression of the protease was induced with IPTG for 1 h, and thecells were infected with ? for three additional hours. The graph illus-trates the resulting phage titer per microliter. Plasmids pBSK? andpAlterEX-2 were used as controls for the ?-GalSCoV 3C-like pro-tease construct and the cI.SCoV repressor, respectively. cI.SCoVmtwas also used as a negative control for the cI.SCoV repressor. Asshown, selection in cells coexpressing the ?-GalSCoV 3C-like pro-tease construct and the cI.SCoV3 repressor resulted in ? replication,whereas the replication of ? was severely compromised in cells express-ing the mutant cI.SCoVmt repressor. Lack of phage replication wasalso observed in cells expressing mutated forms of ?-GalSCoV 3C-like protease that included catalytic-site residue substitutions C145Aand H41A. Similarly, expression of another protease (HCV serineprotease) also prevented phage replication. Values are the means ?standard deviations (error bars) of at least four experiments.VOL. 78, 2004NOTES14059 on June 4, 2015 by FLORIDA INTL UNIV/GL810http:/jvi.asm.org/Downloaded from terization of SCoV 3C-like protease activity. Moreover, thedifferent biological properties of the HIV-1, HCV, and SCoVproteases offered us the opportunity to explore whether thissystem can be used to characterize proteases with differentmechanisms of action. Thus, the cI repressor was modified toreplace the normal site of RecA-mediated cleavage with aSCoV 3C-like protease target cleavage site (Fig. 2B). The co-expression of the cI.SCoV repressor and the SCoV 3C-likeprotease resulted in ? phage replication (Fig. 2C, 3, and 4). Incontrast, phage replication was efficiently repressed in controlcells that did not express the SCoV 3C-like protease (Fig. 3and 4). Therefore, we demonstrate here that this lambda-basedsystem can be used to monitor the catalytic activity of theSCoV 3C-like protease. This simple assay can augment bio-chemical approaches to the analysis of this protease.As mentioned in the beginning of this report, proteases havebeen an attractive target for developing effective HIV-1 andHCV therapeutics, and this seems to be the case for SCoV.SCoV can be detected at 14 days postexposure in 97% ofpatients (19); with influenza virus or rhinoviruses, nearly everypatient will test negative for the virus at day 5 (29). Thisprotracted period of SCoV replication means that there is awindow of opportunity for intervention in SARS with an anti-viral. Another reason for the development of in vitro cell-freeenzymatic methods for the characterization of the differentSCoV proteins is the safety procedures (biosafety level 3 BSL-3) required for SCoV ex vivo propagation. Even BSL-3 equip-ment did not prevent the infection of laboratory researcherswith this virus (17). It is important to emphasize that lastwinter the reported cases of SARS, after the outbreak wascontained in July 2003, were due to laboratory contaminationof researchers working with SCoV (17). The simplicity of oursystem can be seen as a complement to the classical biochem-ical approach for monitoring SCoV 3C-like proteolytic activity.As we and others have previously demonstrated for the HIV-1protease (3, 15, 26), this system allows the characterization ofenzymes with different proteolytic activities. Coupling mutantsequence libraries with this positive genetic selection systemwill allow the study of a huge number of functional mutants.Mutant proteases may be of interest for characterizing thecatalytic properties of the enzyme in the absence or presenceof specific inhibitors as well as for predicting the proteaseinhibitor resistance profile. To perform these experiments us-ing classical biochemical approaches would be difficult andtime-consuming.Recently, a previously undescribed CoV associated with re-spiratory disease of unknown etiology in humans has beenidentified (8, 28). Easily, the system developed in this reportcan be extended to other CoV 3C-like proteases. Here wedeveloped a safe, simple, and rapid genetic screen assay tomonitor the activity of the CoV 3C-like protease. This systemshould be also useful for the development of a screeningmethod to identify SCoV 3C-like protease inhibitors.FIG. 4. The SCoV 3C-like protease reduces the expression levels of cI.CoV. The cI.SCoV and cI.SCoVmt (lane 4) repressors were coexpressedwith the SCoV 3C-like protease. Expression of the protease was induced with IPTG for 3 h. The ODs of the cultures after 3 h (in the presenceof IPTG) were measured to assure that equivalent amounts of total cell protein were blotted. No significant differences were observed when theODs of the different cultures were compared, suggesting that the expression of the SCoV 3C-like protease did not affect the growth of the bacteria.Control proteases with catalytic residue substitutions C145A and H41A and another protease (HCV serine protease) were also included in thisexperiment (lanes 5, 6, and 8, respectively). Lane 7 cells were grown in the absence of IPTG. Reduced signal and cleavage products were observedonly when the wild-type (wt) SCoV 3C-like protease was expressed (lane 1); cleavage products were also observed in the absence of IPTG,suggesting residual expression of the wild-type SCoV 3C-like protease (lane 7). E. coli JM109 cells were cotransformed with pAlterEx-2 repressorplasmids and the pBSK? plasmid containing wild-type or mutated SCoV 3C-like proteases. Cultures were lysed in sodium dodecyl sulfate(SDS)-polyacrylamide gel electrophoresis sample buffer, resolved in 18% gradient SDS-polyacrylamide gels, transferred to nitrocellulose mem-branes, and blocked in phosphate-buffered saline0.1% Tween 2010% nonfat dry milk. For immunochemical detection of the cI.SCoV repressor,membranes were subsequently incubated with rabbit serum containing polyclonal anti-cI antibodies (anti-cI sera; Invitrogen). Bound antibodieswere visualized with peroxidase-linked anti-rabbit immunoglobulin G (Pierce) and the ECL Plus kit (Amersham Biosciences).14060NOTESJ. VIROL. on June 4, 2015 by FLORIDA INTL UNIV/GL810http:/jvi.asm.org/Downloaded from Nucleotide sequence accession number. The SCoV 3C-likeprotease nucleotide sequence constructed and used in the pres-ent work has been submitted to GenBank database under ac-cession number AY609081.This work was supported by Fundacio irsiCaixa.REFERENCES1. Anand, K., G. J. Palm, J. R. Mesters, S. G. Siddell, J. Ziebuhr, and R.Hilgenfeld. 2002. Structure of coronavirus main proteinase reveals combi-nation of a chymotrypsin fold with an extra alpha-helical domain. EMBO J.21:32133224.2. Anand, K., J. Ziebuhr, P. Wadhwani, J. R. Mesters, and R. Hilgenfeld. 2003.Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs. Science 300:17631767.3. Cabana, M., G. Fernandez, M. Parera, B. Clotet, and M. A. Martinez. 2002.Catalytic efficiency and phenotype of HIV-1 proteases encoding single crit-ical resistance substitutions. Virology 300:7178.4. Cello, J., A. V. Paul, and E. Wimmer. 2002. Chemical synthesis of polioviruscDNA: generation of infectious virus in the absence of natural template.Science 297:10161018.5. Drosten, C., S. Gunther, W. Preiser, S. van der Werf, H. R. Brodt, S. Becker,H. Rabenau, M. Panning, L. Kolesnikova, R. A. Fouchier, A. Berger, A. M.Burguiere, J. Cinatl, M. Eickmann, N. Escriou, K. Grywna, S. Kramme, J. C.Manuguerra, S. Muller, V. Rickerts, M. Sturmer, S. Vieth, H. D. Klenk, A. D.Osterhaus, H. Schmitz, and H. W. Doerr. 2003. Identification of a novelcoronavirus in patients with severe acute respiratory syndrome. N. Engl.J. Med. 348:19671976.6. Dunn, B. M. (ed.) 1999. Proteases of infectious agents. Academic Press, SanDiego, Calif.7. Fan, K., P. Wei, Q. Feng, S. Chen, C. Huang, L. Ma, B. Lai, J. Pei, Y. Liu,J. Chen, and L. Lai. 2004. Biosynthesis, purification, and substrate specificityof severe acute respiratory syndrome coronavirus 3C-like proteinase. J. Biol.Chem. 279:16371642.8. Fouchier, R. A., N. G. Hartwig, T. M. Bestebroer, B. Niemeyer, J. C. De Jong,J. H. Simon, and A. D. Osterhaus. 2004. A previously undescribed corona-virus associated with respiratory disease in humans. Proc. Natl. Acad. Sci.USA 101:62126216.9. Fouchier, R. A., T. Kuiken, M. Schutten, G. van Amerongen, G. J. vanDoornum, B. G. van den Hoogen, M. Peiris, W. Lim, K. Stohr, and A. D.Osterhaus. 2003. Aetiology: Kochs postulates fulfilled for SARS virus. Na-ture 423:240.10. Ho, D. D., A. U. Neumann, A. S. Perelson, W. Chen, J. M. Leonard, and M.Markowitz. 1995. Rapid turnover of plasma virions and CD4 lymphocytes inHIV-1 infection. Nature 373:123126.11. Holmes, K. V., and M. M. C. Lai. 1996. Coronaviridae: the viruses and theirreplication, p. 10751094. In B. N. Fields, D. M. Knipe, and P. M. Howley(ed.), Fields virology, 3rd ed., vol. 1. Lippincott-Raven Publishers, Philadel-phia, Pa.12. Ksiazek, T. G., D. Erdman, C. S. Goldsmith, S. R. Zaki, T. Peret, S. Emery,S. Tong, C. Urbani, J. A. Comer, W. Lim, P. E. Rollin, S. F. Dowell, A. E.Ling, C. D. Humphrey, W. J. Shieh, J. Guarner, C. D. Paddock, P. Rota, B.Fields, J. DeRisi, J. Y. Yang, N. Cox, J. M. Hughes, J. W. LeDuc, W. J.Bellini, and L. J. Anderson. 2003. A novel coronavirus associated with severeacute respiratory syndrome. N. Engl. J. Med. 348:19531966.13. Lamarre, D., P. C. Anderson, M. Bailey, P. Beaulieu, G. Bolger, P. Bonneau,M. Bos, D. R. Cameron, M. Cartier, M. G. Cordingley, A. M. Faucher, N.Goudreau, S. H. Kawai, G. Kukolj, L. Lagace, S. R. LaPlante, H. Narjes,M. A. Poupart, J. Rancourt, R. E. Sentjens, R. St George, B. Simoneau, G.Steinmann, D. Thibeault, Y. S. Tsantrizos, S. M. Weldon, C. L. Yong, and M.Llinas-Brunet. 2003. An NS3 protease inhibitor with antiviral effects inhumans infected with hepatitis C virus. Nature 426:186189.14. Marra, M. A., S. J. Jones, C. R. Astell, R. A. Holt, A. Brooks-Wilson, Y. S.Butterfield, J. Khattra, J. K. Asano, S. A. Barber, S. Y. Chan, A. Cloutier,S. M. Coughlin, D. Freeman, N. Girn, O. L. Griffith, S. R. Leach, M. Mayo,H. McDonald, S. B. Montgomery, P. K. Pandoh, A. S. Petrescu, A. G.Robertson, J. E. Schein, A. Siddiqui, D. E. Smailus, J. M. Stott, G. S. Yang,F. Plummer, A. Andonov, H. Artsob, N. Bastien, K. Bernard, T. F. Booth, D.Bowness, M. Czub, M. Drebot, L. Fernando, R. Flick, M. Garbutt, M. Gray,A. Grolla, S. Jones, H. Feldmann, A. Meyers, A. Kabani, Y. Li, S. Normand,U. Stroher, G. A. Tipples, S. Tyler, R. Vogrig, D. Ward, B. Watson, R. C.Brunham, M. Krajden, M. Petric, D. M. Skowronski, C. Upton, and R. L.Roper. 2003. The genome sequence of the SARS-associated coronavirus.Science 300:13991404.15. Martinez, M. A., M. Cabana, M. Parera, A. Gutierrez, J. A. Este, and B.Clotet. 2000. A bacteriophage lambda-based genetic screen for character-ization of the activity and phenotype of the human immunodeficiency virustype 1 protease. Antimicrob. Agents Chemother. 44:11321139.16. Martinez, M. A., and B. Clotet. 2003. Genetic screen for monitoring hepatitisC virus NS3 serine protease activity. Antimicrob. Agents Chemother. 47:17601765.17. Normile, D. 2004. Second lab accident fuels fears about SARS. Science 303:26.18. Pan, W., E. Ravot, R. Tolle, R. Frank, R. Mosbach, I. Turbachova, and H.Bujard. 1999. Vaccine candidate MSP-1 from Plasmodium falciparum: aredesigned 4917 bp polynucleotide enables synthesis and isolation of full-length protein from Escherichia coli and mammalian cells. Nucleic AcidsRes. 27:10941103.19. Peiris, J. S., C. M. Chu, V. C. Cheng, K. S. Chan, I. F. Hung, L. L. Poon, K. I.Law, B. S. Tang, T. Y. Hon, C. S. Chan, K. H. Chan, J. S. Ng, B. J. Zheng,W. L. Ng, R. W. Lai, Y. Guan, and K. Y. Yuen. 2003. Clinical progression andviral load in a community outbreak of coronavirus-associated SARS pneu-monia: a prospective study. Lancet 361:17671772.20. Ptashne, M. 1986. A genetic switch. Cell Press, Cambridge, Mass.21. Rota, P. A., M. S. Oberste, S. S. Monroe, W. A. Nix, R. Campagnoli, J. P.Icenogle, S. Penaranda, B. Bankamp, K. Maher, M. H. Chen, S. Tong, A.Tamin, L. Lowe, M. Frace, J. L. DeRisi, Q. Chen, D. Wang, D. D. Erdman,T. C. Peret, C. Burns, T. G. Ksiazek, P. E. Rollin, A. Sanchez, S. Liffick, B.Holloway, J. Limor, K. McCaustland, M. Olsen-Rasmussen, R. Fouchier, S.Gunther, A. D. Osterhaus, C. Drosten, M. A. Pallansch, L. J. Anderson, andW. J. Bellini. 2003. Characterization of a novel coronavirus associated withsevere acute respiratory syndrome. Science 300:13941399.22. Ruan, Y. J., C. L. Wei, A. L. Ee, V. B. Vega, H. Thoreau, S. T. Su, J. M. Chia,P. Ng, K. P. Chiu, L. Lim, T. Zhang, C. K. Peng, E. O. Lin, N. M. Lee, S. L.Yee, L. F. Ng, R. E. Chee, L. W. Stanton, P. M. Long, and E. T. Liu. 2003.Comparative full-length genome sequence analysis of 14 SARS coronavirusisolates and common mutations associated with putative origins of infection.Lancet 361:17791785.23. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,N.Y.24. Shi, J., Z. Wei, and J. Song. 2004. Dissection study on the SARS 3C-likeprotease reveals the critical role of the extra domain in dimerization of theenzyme: defining the extra domain as a new target for design of highlyspecific protease inhibitors. J. Biol. Chem. 279:2476524773.25. Sices, H. J., and T. M. Kristie. 1998. A genetic screen for the isolation andcharacterization of site-specific proteases. Proc. Natl. Acad. Sci. USA 95:28282833.26. Sices, H. J., M. D. Leusink, A. Pacheco, and T. M. Kristie. 2001. Rapidgenetic selection of inhibitor-resistant protease mutants: clinically relevantand novel mutants of the HIV protease. AIDS Res. Hum. Retroviruses 17:12491255.27. Smith, H. O., C. A. Hutchison III, C. Pfannkoch, and J. C. Venter. 2003.Generating a synthetic genome by whole genome assembly: phiX174 bacte-riophage from synthetic oligonucleotides. Proc. Natl. Acad. Sci. USA 100:1544015445.28. Van Der Hoek, L., K. Pyrc, M. F. Jebbink, W. Vermeulen-Oost, R. J. Berk-hout, K. C. Wolthers, P. M. Wertheim-Van Dillen, J. Kaandorp, J. Spaar-garen, and B. Berkhout. 2004. Identification of a new human coronavirus.Nat. Med. 10:368373.29. Vastag, B. 2003. Old drugs for a new bug: influenza, HIV drugs enlisted tofight SARS. JAMA 290:16951696.30. Wei, X., S. K. Ghosh, M. E. Taylor, V. A. Johnson, E. A. Emini, P. Deutsch,J. D. Lifson, S. Bonhoeffer, M. A. Nowak, B. H. Hahn, et al. 1995. Viraldynamics in human immunodeficiency virus type 1 infection. Nature 373:117122.31. Yang, H., M. Yang, Y. Ding, Y. Liu, Z. Lou, Z. Zhou, L. Sun, L. Mo, S. Ye,H. Pang, G. F. Gao, K. Anand, M. Bartlam, R. Hilgenfeld, and Z. Rao. 2003.The crystal structures of severe acute respiratory syndrome virus main pro-tease and its complex with an inhibitor. Proc. Natl. Acad. Sci. USA 100:1319013195.VOL. 78, 2004NOTES14061 on June 4, 2015 by FLORIDA INTL UNIV/GL810http:/jvi.asm.org/Downloaded from